Glycolaldehyde-modified proteins trigger antagonistic practical and structural aortic transforming resulting in cardiac stress overload


Rising proof helps the position of superior glycation finish merchandise (AGEs) within the growth of diabetic vascular issues and cardiovascular illnesses (CVDs). We have now proven that high-molecularweight AGEs (HMW-AGEs), current in our Western weight-reduction plan, impair cardiac perform.


Whether or not HMW-AGEs have an effect on vascular function stays unknown. On this examine, we aimed to analyze the affect of persistent HMW-AGEs publicity on vascular perform and construction. Grownup male Sprague Dawley rats had been every day injected with HMW-AGEs or management answer for six weeks. HMW-AGEs animals confirmed intracardiac stress overload, characterised by elevated systolic and imply pressures. The contraction response to PE was elevated in aortic rings from the HMW-AGEs group. Leisure in response to ACh, however not SNP, was impaired by HMW-AGEs.

NATtrol Chlamydia trachomatis Constructive Management Pack (6 X 1.25 mL)

This was related to lowered plasma cyclic GMP ranges. SOD restored ACh-induced leisure of HMW-AGEs animals to manage ranges, accompanied by a lowered half-maximal efficient dose (EC50).


Lastly, collagen deposition and intima-media thickness of the aortic vessel wall had been elevated with HMW-AGEs. Our information exhibit that persistent HMW-AGEs publicity triggers antagonistic vascular remodelling. That is characterised by disturbed vasomotor perform resulting from elevated oxidative stress and structural adjustments within the aorta, suggesting an vital contribution of HMW-AGEs within the growth of CVDs.


Positive control tissue section for each antibody; Based on availability INQUIRE
Control-Slides Set of 5
EUR 176
NATtrol Chlamydia trachomatis Positive Control (6 X 1 mL)
NATCT(434)-6MC 6 X 1 mL
EUR 330.8
  • What is the product classification?
  • NATtrol Chlamydia trachomatis Positive Control is marked as RUO.
NATtrol Chlamydia trachomatis Positive Control Pack (6 X 1.25 mL)
MDZ002 6 X 1.25 mL
EUR 371.36
  • What is the product classification?
  • NATtrol Chlamydia trachomatis Positive Control Pack is marked as CE/IVD.
Positive Control for Anti-Rat CYP3A2 Antibody
P3A2PTCON 100 uL
EUR 125
Positive Control for Anti-Human CYP3A Antibody
P3ACON 100 uL
EUR 125
Positive Control for Anti-Human CYP1A2 Antibody
P1A2CON 100 uL
EUR 125
Positive Control for Anti-Rat CYP2B1 Antibody
P2B1PTCON 100 uL
EUR 125
Positive Control for Anti-Rat CYP2C Antibody
P2CCON 100 uL
EUR 125
Positive Control for Anti-Rat CYP2D Antibody
P2DCON 100 uL
EUR 125
Positive Control for Anti-Human CYP2E1 Antibody
P2E1PTCON 100 uL
EUR 125
Positive Control for Anti-Rat MEH Antibody
EUR 125
Positive Control for Anti-Human CYP1B1 Antibody
PH1B1CON 100 uL
EUR 125
Antistreptolysin O positive control
35-AC65 100 ml
EUR 930
Rheumatoid Factor Positive Control
35-RC25 5 ml
EUR 246
QPCR Positive Control Kit
EUR 403
Positive Control for Anti-Human Cytochrome b5 Antibody
Cb5CON 100 uL
EUR 125
Positive Control for Anti-Rat CYP1A1/1A2 Antibody
P1ACON 100 uL
EUR 125
Positive Control for Anti-Rat CHP2B1/2 Antibody
P2B12PTCON 100 uL
EUR 125
Human Salivary Amylase protein positive control for WB
SAMY16-C 100 ul
EUR 286
pMC.CMV-GFP-SV40PolyA (positive control)
MN601A-1 10 ug
EUR 735
  • Category: Minicircle Technology
pMC.CMV-rRFP-SV40PolyA (positive control)
MN602A-1 10 ug
EUR 735
  • Category: Minicircle Technology
pRedZeo-CMV Plasmid [positive control]
SR10046PA-1 10 ug
EUR 535
  • Category: Stem Cell Products
pRedZeo-CMV Virus [positive control]
SR10046VA-1 >2 x 10^6 IFUs
EUR 689
  • Category: Stem Cell Products
pRedTK-CMV Plasmid [positive control]
SR10052PA-1 10 ug
EUR 535
  • Category: Stem Cell Products
pRedTK-CMV Virus [positive control]
SR10052VA-1 >2 x 10^6 IFUs
EUR 689
  • Category: Stem Cell Products
pGreenZeo-CMV Plasmid [positive control]
SR501PA-1 10 ug
EUR 535
  • Category: Stem Cell Products
pGreenZeo-CMV Virus [positive control]
SR501VA-1 >2 x 10^6 IFUs
EUR 672
  • Category: Stem Cell Products
Positive Control for anti-GST p-forms: rat P
GSTCON3 100 uL
EUR 125
Lectin binding native protein (positive control for SNA lectin)
LBP16-N-1 1 ml
EUR 225
Malondialdehyde (MDA)-BSA Conjugate positive control for Western/ELISA
MDA35-N-100 100 ug
EUR 286
Goat IgG (-ve control for flow cytometry) (isotype control)
20011-100 100 test
EUR 103
BSA Control for Age-BSA
EUR 175
BSA Control for AGE-BSA
35R-AA007 10 mg
EUR 224
Core Panel Multi-Tumor control slides
TS900 Set of 5
EUR 218
Core Panel Multi-Tumor control slides
TS900-25 Set of 25
EUR 485
Breast Panel Multi-Tumor control slides
TS901 Set of 5
EUR 218
Breast Panel Multi-Tumor control slides
TS901-25 Set of 25
EUR 485
Positive Control for anti-GST m-forms: rat M1 (Yb)
GSTCON2 100 uL
EUR 125
Positive Control for anti-GST m-forms: rat M2 (Yb2)
GSTCON21 100 uL
EUR 125
Lectin binding native protein (positive control for ConA, WGA lectins)
LBP15-N-1 1 ml
EUR 225
Chicken Bovine brain tubulin protein positive control for Western blot
TUBL15-C 100 ul
EUR 286
Lectin binding native protein (positive control)
LBP18-N-1 1 ml
EUR 225
NATtrol Candida/TV Positive Control (ea)
EUR 407.76
  • What is the product classification?
  • NATtrol Candida/TV Positive Control is marked as RUO.
Control siRNA Vector (pGB-control)
EUR 338
NATtrol Chlamydia trachomatis serotype D, External Run Control, Medium (6X1mL)
EUR 401.52
  • What is the product classification?
  • NATtrol Chlamydia trachomatis serotype D, External Run Control, Medium is marked as RUO.
Ferret IgG (Control, non-immune, isotype control), semi-pure for ELISA
20021-1 100 ug
EUR 225
Elk IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20024-1 100 ug
EUR 225
Deer IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20024-2 100 ug
EUR 225
Bison IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20025-1 100 ug
EUR 225
Raccoon IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20026-1 100 ug
EUR 225
Skunk IgG, semi-pure for ELISA (Control, non-immune, isotype control)
20027-1 100 ug
EUR 225
Control for DOG1, 3 cases (1.5mm)
DOG1061 1
EUR 85
Control for Ckit, 6 samples (1.5mm)
CKIT061 1
EUR 85
Control for HER2, 4 cases (1.5mm)
HRC081 1
EUR 85
SLLK, Control Peptide for TSP1 Inhibitor
HY-P0301 1mg
EUR 133
Control for ER, 4 cases (1.5mm)
ERC081 1
EUR 85
Control for PR, 3 cases (1.5mm)
PRC061 1
EUR 85
PAS/Glycogen, For Digestion (Control Slides)
TCS0024-100 100 Slides
EUR 706
PAS/Glycogen, For Digestion (Control Slides)
TCS0024-25 25 Slides
EUR 232
PAS/Glycogen, For Digestion (Control Slides)
TCS0024-5 5 Slides
EUR 98
Thiostatin Rat protein, control for western
TSTN11-C 100 ul
EUR 286
Control/Blocking peptide for Human WNT5a
WNT511-P 100 ug
EUR 164
Positive Control for anti-GST a-forms: rat A1+A2 (Ya)
GSTCON1 100 uL
EUR 125
Positive Control for anti-GST a-forms: rat A3+A4 (Yc)
GSTCON11 100 uL
EUR 125
NATtrol BV Positive Control (6 X 0.15mL)
EUR 407.76
  • What is the product classification?
  • NATtrol BV Positive Control is marked as RUO.
NATtrol RSV Positive Control (6 x 0.5mL)
NATRSV-6C 6 x 0.5mL
EUR 232
  • What is the product classification?
  • NATtrol RSV Positive Control is marked as RUO.
NATtrol Chlamydia trachomatis LGV II 434, External Run Control, Medium (6X1mL)
EUR 401.52
  • What is the product classification?
  • NATtrol Chlamydia trachomatis LGV II 434, External Run Control, Medium is marked as RUO.
Quality Control
abx098966-1vial 1 vial
EUR 300
  • Shipped within 5-7 working days.
pMD18- Control
PVT10563 2 ug
EUR 266
pMD19- Control
PVT10564 2 ug
EUR 266
Rabbit Anti-B. pertussis Toxin IgM positive control for ELISA, IF, Western
PTOX16-S 1 ml
EUR 225
Rabbit Anti-B. pertussis Toxin IgG positive control for ELISA, IF, Western
PTOX18-S 1 ml
EUR 225
Mouse Anti-C. tetani toxin Light-chain antibody positive control for ELISA
TTOX17-PC 1 ml
EUR 286
Donkey IgG (Control, non-immune, isotype control)
20028-1 1 mg
EUR 164
Rat neurofascin (Nfasc)-control Control/blocking peptide
AB-23249-CP 100ug
EUR 164
Breast Tumor Tissue Array - 64 Different Breast tumors. Plus positive control and negative control
T8235721-2 2 slides
EUR 307
Breast Tumor Tissue Array - 64 Different Breast tumors. Plus positive control and negative control
T8235721-5 5 slides
EUR 579
Colon Tumor Tissue Array - 64 Different Colon tumors. Plus positive control and negative control
T8235722-2 2 slides
EUR 307
Colon Tumor Tissue Array - 64 Different Colon tumors. Plus positive control and negative control
T8235722-5 5 slides
EUR 579
Rectum Tumor Tissue Array - 64 Different Rectum tumors. Plus positive control and negative control
T8235723-2 2 slides
EUR 307
Rectum Tumor Tissue Array - 64 Different Rectum tumors. Plus positive control and negative control
T8235723-5 5 slides
EUR 579
Lung Tumor Tissue Array - 64 Different Lung tumors. Plus positive control and negative control
T8235724-2 2 slides
EUR 307
Lung Tumor Tissue Array - 64 Different Lung tumors. Plus positive control and negative control
T8235724-5 5 slides
EUR 579
Ovary Tumor Tissue Array - 64 Different Ovary tumors. Plus positive control and negative control
T8235725-2 2 slides
EUR 307
Ovary Tumor Tissue Array - 64 Different Ovary tumors. Plus positive control and negative control
T8235725-5 5 slides
EUR 579

Twin inhibitors of SARS-CoV-2 proteases: pharmacophore and molecular dynamics primarily based drug repositioning and phytochemical leads


  • SARS-related coronaviruses poses continuous risk to humanity by quickly mutating and rising as extreme pandemic outbreaks, together with the present nCoV-19 pandemic. Therefore a speedy drug repositioning and lead identification technique are required to mitigate these outbreaks. We report a pharmacophore and molecular dynamics-based method for drug repositioning and lead identification in opposition to twin targets (3CLp and PLp) of SARS-CoV-2.

         Lectin binding native protein (constructive management for SNA lectin)

  • The pharmacophore mannequin of 3CLp inhibitors was apolar with two fragrant and two H-bond acceptors, whereas that of PLp was comparatively polar, bearing one fragrant and three H-bond acceptors. Pharmacophore-based digital screening yielded six present FDA-approved medication and twelve pure professionalducts with each the pharmacophoric options.


  • Amongst them are nelfinavir, tipranavir and licochalcone-D, which has proven higher binding traits with each the proteases in comparison with lopinavir. The molecular dynamics revealed that the connecting loop (residues 176-199) of 3CLp is very versatile, and therefore, inhibitors ought to keep away from high-affinity interactions with it.

          Colon Tumor Tissue Array – 64 Totally different Colon tumors. Plus constructive management and adverse management

  • Lopinavir, resulting from its excessive affinity with the loop area, exhibited unstable binding. Additional, the van der Waals dimension of the 3CLp inhibitors positively correlated with their binding affinity with 3CLp. Nonetheless, the van der Waals dimension of a ligand mustn’t cross a threshold of 572Å3, past which the ligands are prone to make high-affinity interplay with the loop and endure unsteady binding as noticed within the case of lopinavir. Equally, the entire polar floor space of the ligands had been discovered to be negatively correlated with their binding affinity with PLp.

Anti-TNFRSF25 antibody

STJ111829 100 µl
EUR 277

Anti-TNFRSF25 antibody

STJ116474 100 µl
EUR 277

Anti-DR3/TNFRSF25 Antibody

PA2004 100ug/vial
EUR 294

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

TNFRSF25 antibody

70R-10465 50 ug
EUR 467

TNFRSF25 Antibody

35717-100ul 100ul
EUR 252

TNFRSF25 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified

TNFRSF25 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.

TNFRSF25 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human TNFRSF25 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-40008h 96 Tests
EUR 824

TNFRSF25 Rabbit pAb

A14261-100ul 100 ul
EUR 308

TNFRSF25 Rabbit pAb

A14261-200ul 200 ul
EUR 459

TNFRSF25 Rabbit pAb

A14261-20ul 20 ul
EUR 183

TNFRSF25 Rabbit pAb

A14261-50ul 50 ul
EUR 223

TNFRSF25 Blocking Peptide

33R-3528 100 ug
EUR 180

TNFRSF25 Conjugated Antibody

C35717 100ul
EUR 397

TNFRSF25 cloning plasmid

CSB-CL839000HU-10ug 10ug
EUR 461
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atggagcagcggccgcggggctgcgcggcggtggcggcggcgctcctcctggtgctgctgggggcccgggcccagggcggcactcgtagccccaggtgtgactgtgccggtgacttccacaagaagattggtctgttttgttgcagaggctgcccagcggggcactacctgaagg
  • Show more

TNFRSF25 Rabbit pAb

A9783-100ul 100 ul
EUR 308

TNFRSF25 Rabbit pAb

A9783-200ul 200 ul
EUR 459

TNFRSF25 Rabbit pAb

A9783-20ul 20 ul Ask for price

TNFRSF25 Rabbit pAb

A9783-50ul 50 ul Ask for price

pDONR223-TNFRSF25 Plasmid

PVTB01130-1 2 ug
EUR 356

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

TNFRSF25 ORF Vector (Human) (pORF)

ORF014787 1.0 ug DNA
EUR 354

TNFRSF25 ELISA Kit (Human) (OKBB01104)

OKBB01104 96 Wells
EUR 505

TNFRSF25 ELISA Kit (Human) (OKCA00847)

OKCA00847 96 Wells
EUR 833

TNFRSF25 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified

TNFRSF25 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified

TNFRSF25 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified

Polyclonal TNFRSF25 / DR3 Antibody

APR02680G 0.05ml
EUR 484

Polyclonal TNFRSF25 / DR3 Antibody

APR02955G 0.05mg
EUR 484

Polyclonal TNFRSF25 Antibody (Center)

APR04205G 0.1ml
EUR 484

ELISA kit for Human TNFRSF25/DR3

EK5755 96 tests
EUR 553

Human TNFRSF25/DR3 PicoKine ELISA Kit

EK1579 96 wells
EUR 425

TNFRSF25 sgRNA CRISPR Lentivector set (Human)

K2416901 3 x 1.0 ug
EUR 339

Recombinant Human TNFRSF25/DR3/TNFRSF12 Protein

RP00464 10 μg
EUR 174

Polyclonal TNFRSF25 antibody - middle region

APR01898G 0.05mg
EUR 528

Tnfrsf25 ORF Vector (Rat) (pORF)

ORF078025 1.0 ug DNA
EUR 506

Tnfrsf25 ORF Vector (Mouse) (pORF)

ORF060084 1.0 ug DNA
EUR 506

TNFRSF25 ELISA Kit (Mouse) (OKBB01049)

OKBB01049 96 Wells
EUR 505

TNFRSF25 sgRNA CRISPR Lentivector (Human) (Target 1)

K2416902 1.0 ug DNA
EUR 154

TNFRSF25 sgRNA CRISPR Lentivector (Human) (Target 2)

K2416903 1.0 ug DNA
EUR 154

TNFRSF25 sgRNA CRISPR Lentivector (Human) (Target 3)

K2416904 1.0 ug DNA
EUR 154

TNFRSF25 Protein Vector (Human) (pPB-C-His)

PV059145 500 ng
EUR 481

TNFRSF25 Protein Vector (Human) (pPB-N-His)

PV059146 500 ng
EUR 481

TNFRSF25 Protein Vector (Human) (pPM-C-HA)

PV059147 500 ng
EUR 481

TNFRSF25 Protein Vector (Human) (pPM-C-His)

PV059148 500 ng
EUR 481

Polyclonal TNFRSF25 / DR3 Antibody (Extracellular Domain)

APR02518G 0.05mg
EUR 484

Polyclonal TNFRSF25 / DR3 Antibody (aa25-40)

APR02519G 0.05mg
EUR 484

ELISA kit for Mouse TNFRSF25/DR3

EK5714 96 tests
EUR 553

Mouse TNFRSF25/DR3 PicoKine ELISA Kit

EK1515 96 wells
EUR 425

Tnfrsf25 sgRNA CRISPR Lentivector set (Rat)

K6493001 3 x 1.0 ug
EUR 339

Tnfrsf25 sgRNA CRISPR Lentivector set (Mouse)

K3774801 3 x 1.0 ug
EUR 339

Human Tumor necrosis factor receptor superfamily member 25 (TNFRSF25)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 22.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.

Human TNF Receptor Superfamily Member 25 (TNFRSF25) ELISA Kit

abx259548-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Recombinant Human Death Receptor 3/DR3/TNFRSF25 (C-Fc)

CJ74-10ug 10ug
EUR 141

Recombinant Human Death Receptor 3/DR3/TNFRSF25 (C-Fc)

CJ74-1mg 1mg
EUR 1674

Recombinant Human Death Receptor 3/DR3/TNFRSF25 (C-Fc)

CJ74-500ug 500ug
EUR 1115

Recombinant Human Death Receptor 3/DR3/TNFRSF25 (C-Fc)

CJ74-50ug 50ug
EUR 303

Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-100ug

QP7891-ec-100ug 100ug
EUR 408

Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-10ug

QP7891-ec-10ug 10ug
EUR 200

Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-1mg

QP7891-ec-1mg 1mg
EUR 1632

Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-200ug

QP7891-ec-200ug 200ug
EUR 634

Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-500ug

QP7891-ec-500ug 500ug
EUR 1060

Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-50ug

QP7891-ec-50ug 50ug
EUR 263

TNF Receptor Superfamily Member 25 (TNFRSF25) Antibody

abx412445-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

TNF Receptor Superfamily Member 25 (TNFRSF25) Antibody

abx412446-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

Monoclonal TNFRSF25 Antibody (monoclonal) (M06), Clone: 4E4

AMM04216G 0.1mg
EUR 484

Tnfrsf25 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6493002 1.0 ug DNA
EUR 154

Tnfrsf25 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6493003 1.0 ug DNA
EUR 154

Tnfrsf25 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6493004 1.0 ug DNA
EUR 154

Tnfrsf25 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3774802 1.0 ug DNA
EUR 154

Tnfrsf25 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3774803 1.0 ug DNA
EUR 154

Tnfrsf25 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3774804 1.0 ug DNA
EUR 154

TNFRSF25 Protein Vector (Rat) (pPB-C-His)

PV312098 500 ng
EUR 603

TNFRSF25 Protein Vector (Rat) (pPB-N-His)

PV312099 500 ng
EUR 603
  • Key phrases: 3CL-protease; PL-protease; Pharmacophore; SARS-CoV-2 inhibitors; anti-HIV medicationmolecular dynamics; pure merchandise; protease inhibitors.

      Recombinant Human TNFRSF25/DR3/TNFRSF12 Protein

  • The purpose of the current work was the event of a novel glycosaminoglycan (GAG)-based injectable formulation meant for intra-articular administration that ought to finest mimic the healthy synovial fluid.


  • Hyaluronic acid (HA) was selectedn amongst GAG polymers, since it’s the most ample element of the synovial fluid. A DoE (Design of Experiment) method was used for the event of a formulation containing two HA (very excessive (VHMW) and low (LMW) molecular weight) grades. The rationale for this alternative is that thus far, no industrial product