Glycolaldehyde-modified proteins trigger antagonistic practical and structural aortic transforming resulting in cardiac stress overload
Rising proof helps the position of superior glycation finish merchandise (AGEs) within the growth of diabetic vascular issues and cardiovascular illnesses (CVDs). We have now proven that high-molecular–weight AGEs (HMW-AGEs), current in our Western weight-reduction plan, impair cardiac perform.
Whether or not HMW-AGEs have an effect on vascular function stays unknown. On this examine, we aimed to analyze the affect of persistent HMW-AGEs publicity on vascular perform and construction. Grownup male Sprague Dawley rats had been every day injected with HMW-AGEs or management answer for six weeks. HMW-AGEs animals confirmed intracardiac stress overload, characterised by elevated systolic and imply pressures. The contraction response to PE was elevated in aortic rings from the HMW-AGEs group. Leisure in response to ACh, however not SNP, was impaired by HMW-AGEs.
NATtrol Chlamydia trachomatis Constructive Management Pack (6 X 1.25 mL)
This was related to lowered plasma cyclic GMP ranges. SOD restored ACh-induced leisure of HMW-AGEs animals to manage ranges, accompanied by a lowered half-maximal efficient dose (EC50).
Lastly, collagen deposition and intima-media thickness of the aortic vessel wall had been elevated with HMW-AGEs. Our information exhibit that persistent HMW-AGEs publicity triggers antagonistic vascular remodelling. That is characterised by disturbed vasomotor perform resulting from elevated oxidative stress and structural adjustments within the aorta, suggesting an vital contribution of HMW-AGEs within the growth of CVDs.

Positive control tissue section for each antibody; Based on availability INQUIRE |
Control-Slides |
Innovex |
Set of 5 |
EUR 176.00 |
NATtrol Chlamydia trachomatis Positive Control (6 X 1 mL) |
NATCT(434)-6MC |
Zeptometrix |
6 X 1 mL |
EUR 330.80 |
- What is the product classification?
- NATtrol Chlamydia trachomatis Positive Control is marked as RUO.
|
NATtrol Chlamydia trachomatis Positive Control Pack (6 X 1.25 mL) |
MDZ002 |
Zeptometrix |
6 X 1.25 mL |
EUR 371.36 |
- What is the product classification?
- NATtrol Chlamydia trachomatis Positive Control Pack is marked as CE/IVD.
|
Positive Control for Anti-Human CYP1A2 Antibody |
P1A2CON |
Detroit R&D |
100 uL |
EUR 125.00 |
Positive Control for Anti-Human CYP1B1 Antibody |
PH1B1CON |
Detroit R&D |
100 uL |
EUR 125.00 |
Positive Control for Anti-Rat MEH Antibody |
MEHCON |
Detroit R&D |
100 uL |
EUR 125.00 |
Positive Control for Anti-Rat CYP2B1 Antibody |
P2B1PTCON |
Detroit R&D |
100 uL |
EUR 125.00 |
Positive Control for Anti-Rat CYP2C Antibody |
P2CCON |
Detroit R&D |
100 uL |
EUR 125.00 |
Positive Control for Anti-Rat CYP2D Antibody |
P2DCON |
Detroit R&D |
100 uL |
EUR 125.00 |
Positive Control for Anti-Human CYP2E1 Antibody |
P2E1PTCON |
Detroit R&D |
100 uL |
EUR 125.00 |
Positive Control for Anti-Rat CYP3A2 Antibody |
P3A2PTCON |
Detroit R&D |
100 uL |
EUR 125.00 |
Positive Control for Anti-Human CYP3A Antibody |
P3ACON |
Detroit R&D |
100 uL |
EUR 125.00 |
Antistreptolysin O positive control |
35-AC65 |
Fitzgerald |
100 ml |
EUR 930.00 |
Rheumatoid Factor Positive Control |
35-RC25 |
Fitzgerald |
5 ml |
EUR 246.00 |
QPCR Positive Control Kit |
M1126-100 |
Biovision |
|
EUR 403.00 |
Positive Control for Anti-Human Cytochrome b5 Antibody |
Cb5CON |
Detroit R&D |
100 uL |
EUR 125.00 |
Positive Control for Anti-Rat CYP1A1/1A2 Antibody |
P1ACON |
Detroit R&D |
100 uL |
EUR 125.00 |
Positive Control for Anti-Rat CHP2B1/2 Antibody |
P2B12PTCON |
Detroit R&D |
100 uL |
EUR 125.00 |
Human Salivary Amylase protein positive control for WB |
SAMY16-C |
Alpha Diagnostics |
100 ul |
EUR 286.00 |
pMC.CMV-GFP-SV40PolyA (positive control) |
MN601A-1 |
SBI |
10 ug |
EUR 735.00 |
- Category: Minicircle Technology
|
pMC.CMV-rRFP-SV40PolyA (positive control) |
MN602A-1 |
SBI |
10 ug |
EUR 735.00 |
- Category: Minicircle Technology
|
pRedZeo-CMV Plasmid [positive control] |
SR10046PA-1 |
SBI |
10 ug |
EUR 535.00 |
- Category: Stem Cell Products
|
pRedZeo-CMV Virus [positive control] |
SR10046VA-1 |
SBI |
>2 x 10^6 IFUs |
EUR 689.00 |
- Category: Stem Cell Products
|
pRedTK-CMV Plasmid [positive control] |
SR10052PA-1 |
SBI |
10 ug |
EUR 535.00 |
- Category: Stem Cell Products
|
pRedTK-CMV Virus [positive control] |
SR10052VA-1 |
SBI |
>2 x 10^6 IFUs |
EUR 689.00 |
- Category: Stem Cell Products
|
pGreenZeo-CMV Plasmid [positive control] |
SR501PA-1 |
SBI |
10 ug |
EUR 535.00 |
- Category: Stem Cell Products
|
pGreenZeo-CMV Virus [positive control] |
SR501VA-1 |
SBI |
>2 x 10^6 IFUs |
EUR 672.00 |
- Category: Stem Cell Products
|
Positive Control for anti-GST p-forms: rat P |
GSTCON3 |
Detroit R&D |
100 uL |
EUR 125.00 |
Malondialdehyde (MDA)-BSA Conjugate positive control for Western/ELISA |
MDA35-N-100 |
Alpha Diagnostics |
100 ug |
EUR 286.00 |
Lectin binding native protein (positive control for SNA lectin) |
LBP16-N-1 |
Alpha Diagnostics |
1 ml |
EUR 225.00 |
Goat IgG (-ve control for flow cytometry) (isotype control) |
20011-100 |
Alpha Diagnostics |
100 test |
EUR 103.00 |
BSA Control for AGE-BSA |
35R-AA007 |
Fitzgerald |
10 mg |
EUR 224.00 |
BSA Control for Age-BSA |
2221-BSA |
Biovision |
|
EUR 175.00 |
Core Panel Multi-Tumor control slides |
TS900 |
Innovex |
Set of 5 |
EUR 218.00 |
Core Panel Multi-Tumor control slides |
TS900-25 |
Innovex |
Set of 25 |
EUR 485.00 |
Breast Panel Multi-Tumor control slides |
TS901 |
Innovex |
Set of 5 |
EUR 218.00 |
Breast Panel Multi-Tumor control slides |
TS901-25 |
Innovex |
Set of 25 |
EUR 485.00 |
Positive Control for anti-GST m-forms: rat M1 (Yb) |
GSTCON2 |
Detroit R&D |
100 uL |
EUR 125.00 |
Positive Control for anti-GST m-forms: rat M2 (Yb2) |
GSTCON21 |
Detroit R&D |
100 uL |
EUR 125.00 |
Lectin binding native protein (positive control for ConA, WGA lectins) |
LBP15-N-1 |
Alpha Diagnostics |
1 ml |
EUR 225.00 |
Chicken Bovine brain tubulin protein positive control for Western blot |
TUBL15-C |
Alpha Diagnostics |
100 ul |
EUR 286.00 |
NATtrol Candida/TV Positive Control (ea) |
NATCTVPOS-BD |
Zeptometrix |
ea |
EUR 407.76 |
- What is the product classification?
- NATtrol Candida/TV Positive Control is marked as RUO.
|
Lectin binding native protein (positive control) |
LBP18-N-1 |
Alpha Diagnostics |
1 ml |
EUR 225.00 |
Control siRNA Vector (pGB-control) |
9500C-20 |
Biovision |
|
EUR 338.00 |
NATtrol Chlamydia trachomatis serotype D, External Run Control, Medium (6X1mL) |
NATCT(D-UW3)-ERCM |
Zeptometrix |
6X1mL |
EUR 401.52 |
- What is the product classification?
- NATtrol Chlamydia trachomatis serotype D, External Run Control, Medium is marked as RUO.
|
Ferret IgG (Control, non-immune, isotype control), semi-pure for ELISA |
20021-1 |
Alpha Diagnostics |
100 ug |
EUR 225.00 |
Elk IgG, semi-pure for ELISA (Control, non-immune, isotype control) |
20024-1 |
Alpha Diagnostics |
100 ug |
EUR 225.00 |
Deer IgG, semi-pure for ELISA (Control, non-immune, isotype control) |
20024-2 |
Alpha Diagnostics |
100 ug |
EUR 225.00 |
Bison IgG, semi-pure for ELISA (Control, non-immune, isotype control) |
20025-1 |
Alpha Diagnostics |
100 ug |
EUR 225.00 |
Raccoon IgG, semi-pure for ELISA (Control, non-immune, isotype control) |
20026-1 |
Alpha Diagnostics |
100 ug |
EUR 225.00 |
Skunk IgG, semi-pure for ELISA (Control, non-immune, isotype control) |
20027-1 |
Alpha Diagnostics |
100 ug |
EUR 225.00 |
Control for HER2, 4 cases (1.5mm) |
HRC081 |
Pantomics |
1 |
EUR 85.00 |
Control for ER, 4 cases (1.5mm) |
ERC081 |
Pantomics |
1 |
EUR 85.00 |
SLLK, Control Peptide for TSP1 Inhibitor |
HY-P0301 |
MedChemExpress |
1mg |
EUR 133.00 |
Control for DOG1, 3 cases (1.5mm) |
DOG1061 |
Pantomics |
1 |
EUR 85.00 |
Control for Ckit, 6 samples (1.5mm) |
CKIT061 |
Pantomics |
1 |
EUR 85.00 |
Control for PR, 3 cases (1.5mm) |
PRC061 |
Pantomics |
1 |
EUR 85.00 |
PAS/Glycogen, For Digestion (Control Slides) |
TCS0024-100 |
ScyTek Laboratories |
100 Slides |
EUR 706.00 |
PAS/Glycogen, For Digestion (Control Slides) |
TCS0024-25 |
ScyTek Laboratories |
25 Slides |
EUR 232.00 |
Thiostatin Rat protein, control for western |
TSTN11-C |
Alpha Diagnostics |
100 ul |
EUR 286.00 |
Control/Blocking peptide for Human WNT5a |
WNT511-P |
Alpha Diagnostics |
100 ug |
EUR 164.00 |
Positive Control for anti-GST a-forms: rat A1+A2 (Ya) |
GSTCON1 |
Detroit R&D |
100 uL |
EUR 125.00 |
Positive Control for anti-GST a-forms: rat A3+A4 (Yc) |
GSTCON11 |
Detroit R&D |
100 uL |
EUR 125.00 |
NATtrol BV Positive Control (6 X 0.15mL) |
NATBVPOS-BD |
Zeptometrix |
6 X 0.15mL |
EUR 407.76 |
- What is the product classification?
- NATtrol BV Positive Control is marked as RUO.
|
NATtrol RSV Positive Control (6 x 0.5mL) |
NATRSV-6C |
Zeptometrix |
6 x 0.5mL |
EUR 232.00 |
- What is the product classification?
- NATtrol RSV Positive Control is marked as RUO.
|
NATtrol Chlamydia trachomatis LGV II 434, External Run Control, Medium (6X1mL) |
NATCT(434)-ERCM |
Zeptometrix |
6X1mL |
EUR 401.52 |
- What is the product classification?
- NATtrol Chlamydia trachomatis LGV II 434, External Run Control, Medium is marked as RUO.
|
Quality Control |
abx098966-1vial |
Abbexa |
1 vial |
EUR 300.00 |
- Shipped within 5-7 working days.
|
Rabbit Anti-B. pertussis Toxin IgM positive control for ELISA, IF, Western |
PTOX16-S |
Alpha Diagnostics |
1 ml |
EUR 225.00 |
Rabbit Anti-B. pertussis Toxin IgG positive control for ELISA, IF, Western |
PTOX18-S |
Alpha Diagnostics |
1 ml |
EUR 225.00 |
Mouse Anti-C. tetani toxin Light-chain antibody positive control for ELISA |
TTOX17-PC |
Alpha Diagnostics |
1 ml |
EUR 286.00 |
Rat neurofascin (Nfasc)-control Control/blocking peptide |
AB-23249-CP |
Alpha Diagnostics |
100ug |
EUR 164.00 |
Donkey IgG (Control, non-immune, isotype control) |
20028-1 |
Alpha Diagnostics |
1 mg |
EUR 164.00 |
Breast Tumor Tissue Array - 64 Different Breast tumors. Plus positive control and negative control |
T8235721-2 |
Biochain |
2 slides |
EUR 307.00 |
Breast Tumor Tissue Array - 64 Different Breast tumors. Plus positive control and negative control |
T8235721-5 |
Biochain |
5 slides |
EUR 579.00 |
Colon Tumor Tissue Array - 64 Different Colon tumors. Plus positive control and negative control |
T8235722-2 |
Biochain |
2 slides |
EUR 307.00 |
Colon Tumor Tissue Array - 64 Different Colon tumors. Plus positive control and negative control |
T8235722-5 |
Biochain |
5 slides |
EUR 579.00 |
Rectum Tumor Tissue Array - 64 Different Rectum tumors. Plus positive control and negative control |
T8235723-2 |
Biochain |
2 slides |
EUR 307.00 |
Rectum Tumor Tissue Array - 64 Different Rectum tumors. Plus positive control and negative control |
T8235723-5 |
Biochain |
5 slides |
EUR 579.00 |
Lung Tumor Tissue Array - 64 Different Lung tumors. Plus positive control and negative control |
T8235724-2 |
Biochain |
2 slides |
EUR 307.00 |
Lung Tumor Tissue Array - 64 Different Lung tumors. Plus positive control and negative control |
T8235724-5 |
Biochain |
5 slides |
EUR 579.00 |
Ovary Tumor Tissue Array - 64 Different Ovary tumors. Plus positive control and negative control |
T8235725-2 |
Biochain |
2 slides |
EUR 307.00 |
Ovary Tumor Tissue Array - 64 Different Ovary tumors. Plus positive control and negative control |
T8235725-5 |
Biochain |
5 slides |
EUR 579.00 |
Twin inhibitors of SARS-CoV-2 proteases: pharmacophore and molecular dynamics primarily based drug repositioning and phytochemical leads
-
SARS-related coronaviruses poses continuous risk to humanity by quickly mutating and rising as extreme pandemic outbreaks, together with the present nCoV-19 pandemic. Therefore a speedy drug repositioning and lead identification technique are required to mitigate these outbreaks. We report a pharmacophore and molecular dynamics-based method for drug repositioning and lead identification in opposition to twin targets (3CLp and PLp) of SARS-CoV-2.
Lectin binding native protein (constructive management for SNA lectin)
-
The pharmacophore mannequin of 3CLp inhibitors was apolar with two fragrant and two H-bond acceptors, whereas that of PLp was comparatively polar, bearing one fragrant and three H-bond acceptors. Pharmacophore-based digital screening yielded six present FDA-approved medication and twelve pure professionalducts with each the pharmacophoric options.
-
Amongst them are nelfinavir, tipranavir and licochalcone-D, which has proven higher binding traits with each the proteases in comparison with lopinavir. The molecular dynamics revealed that the connecting loop (residues 176-199) of 3CLp is very versatile, and therefore, inhibitors ought to keep away from high-affinity interactions with it.
Colon Tumor Tissue Array – 64 Totally different Colon tumors. Plus constructive management and adverse management
-
Lopinavir, resulting from its excessive affinity with the loop area, exhibited unstable binding. Additional, the van der Waals dimension of the 3CLp inhibitors positively correlated with their binding affinity with 3CLp. Nonetheless, the van der Waals dimension of a ligand mustn’t cross a threshold of 572Å3, past which the ligands are prone to make high-affinity interplay with the loop and endure unsteady binding as noticed within the case of lopinavir. Equally, the entire polar floor space of the ligands had been discovered to be negatively correlated with their binding affinity with PLp.
Anti-DR3/TNFRSF25 Antibody |
PA2004 |
BosterBio |
100ug/vial |
EUR 294.00 |
Rabbit Polyclonal antibody Anti-CRBN |
Anti-CRBN |
ImmunoStep |
50 µg |
EUR 349.00 |
TNFRSF25 antibody |
70R-10465 |
Fitzgerald |
50 ug |
EUR 467.00 |
TNFRSF25 Antibody |
35717-100ul |
SAB |
100ul |
EUR 252.00 |
TNFRSF25 Antibody |
1-CSB-PA839000LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
TNFRSF25 Antibody |
1-CSB-PA004866 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
TNFRSF25 Antibody |
1-CSB-PA213899 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
TNFRSF25 siRNA |
20-abx937612 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human TNFRSF25 shRNA Plasmid |
20-abx955739 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TNFRSF25 Rabbit pAb |
A14261-100ul |
Abclonal |
100 ul |
EUR 308.00 |
TNFRSF25 Rabbit pAb |
A14261-200ul |
Abclonal |
200 ul |
EUR 459.00 |
TNFRSF25 Rabbit pAb |
A14261-20ul |
Abclonal |
20 ul |
EUR 183.00 |
TNFRSF25 Rabbit pAb |
A14261-50ul |
Abclonal |
50 ul |
EUR 223.00 |
TNFRSF25 Blocking Peptide |
33R-3528 |
Fitzgerald |
100 ug |
EUR 180.00 |
TNFRSF25 Conjugated Antibody |
C35717 |
SAB |
100ul |
EUR 397.00 |
TNFRSF25 cloning plasmid |
CSB-CL839000HU-10ug |
Cusabio |
10ug |
EUR 461.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1254
- Sequence: atggagcagcggccgcggggctgcgcggcggtggcggcggcgctcctcctggtgctgctgggggcccgggcccagggcggcactcgtagccccaggtgtgactgtgccggtgacttccacaagaagattggtctgttttgttgcagaggctgcccagcggggcactacctgaagg
- Show more
|
TNFRSF25 Rabbit pAb |
A9783-100ul |
Abclonal |
100 ul |
EUR 308.00 |
TNFRSF25 Rabbit pAb |
A9783-200ul |
Abclonal |
200 ul |
EUR 459.00 |
TNFRSF25 Rabbit pAb |
A9783-20ul |
Abclonal |
20 ul |
Ask for price |
TNFRSF25 Rabbit pAb |
A9783-50ul |
Abclonal |
50 ul |
Ask for price |
Polyclonal Goat anti-GST α-form |
GST-ANTI-1 |
Detroit R&D |
50 uL |
EUR 280.00 |
Polyclonal Goat anti-GST μ-form |
GST-ANTI-2 |
Detroit R&D |
50 uL |
EUR 280.00 |
Polyclonal Goat anti-GST p-form |
GST-ANTI-3 |
Detroit R&D |
50 uL |
EUR 280.00 |
TNFRSF25 ORF Vector (Human) (pORF) |
ORF014787 |
ABM |
1.0 ug DNA |
EUR 354.00 |
TNFRSF25 Antibody, HRP conjugated |
1-CSB-PA839000LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
TNFRSF25 Antibody, FITC conjugated |
1-CSB-PA839000LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
TNFRSF25 Antibody, Biotin conjugated |
1-CSB-PA839000LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Polyclonal TNFRSF25 / DR3 Antibody |
APR02680G |
Leading Biology |
0.05ml |
EUR 484.00 |
Polyclonal TNFRSF25 / DR3 Antibody |
APR02955G |
Leading Biology |
0.05mg |
EUR 484.00 |
Polyclonal TNFRSF25 Antibody (Center) |
APR04205G |
Leading Biology |
0.1ml |
EUR 484.00 |
ELISA kit for Human TNFRSF25/DR3 |
EK5755 |
SAB |
96 tests |
EUR 553.00 |
Human TNFRSF25/DR3 PicoKine ELISA Kit |
EK1579 |
BosterBio |
96 wells |
EUR 425.00 |
TNFRSF25 sgRNA CRISPR Lentivector set (Human) |
K2416901 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Recombinant Human TNFRSF25/DR3/TNFRSF12 Protein |
RP00464 |
Abclonal |
10 μg |
EUR 174.00 |
Polyclonal TNFRSF25 antibody - middle region |
APR01898G |
Leading Biology |
0.05mg |
EUR 528.00 |
Tnfrsf25 ORF Vector (Rat) (pORF) |
ORF078025 |
ABM |
1.0 ug DNA |
EUR 506.00 |
Tnfrsf25 ORF Vector (Mouse) (pORF) |
ORF060084 |
ABM |
1.0 ug DNA |
EUR 506.00 |
TNFRSF25 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2416902 |
ABM |
1.0 ug DNA |
EUR 154.00 |
TNFRSF25 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2416903 |
ABM |
1.0 ug DNA |
EUR 154.00 |
TNFRSF25 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2416904 |
ABM |
1.0 ug DNA |
EUR 154.00 |
TNFRSF25 Protein Vector (Human) (pPB-C-His) |
PV059145 |
ABM |
500 ng |
EUR 481.00 |
TNFRSF25 Protein Vector (Human) (pPB-N-His) |
PV059146 |
ABM |
500 ng |
EUR 481.00 |
TNFRSF25 Protein Vector (Human) (pPM-C-HA) |
PV059147 |
ABM |
500 ng |
EUR 481.00 |
TNFRSF25 Protein Vector (Human) (pPM-C-His) |
PV059148 |
ABM |
500 ng |
EUR 481.00 |
Polyclonal TNFRSF25 / DR3 Antibody (Extracellular Domain) |
APR02518G |
Leading Biology |
0.05mg |
EUR 484.00 |
Polyclonal TNFRSF25 / DR3 Antibody (aa25-40) |
APR02519G |
Leading Biology |
0.05mg |
EUR 484.00 |
ELISA kit for Mouse TNFRSF25/DR3 |
EK5714 |
SAB |
96 tests |
EUR 553.00 |
Mouse TNFRSF25/DR3 PicoKine ELISA Kit |
EK1515 |
BosterBio |
96 wells |
EUR 425.00 |
Tnfrsf25 sgRNA CRISPR Lentivector set (Rat) |
K6493001 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Tnfrsf25 sgRNA CRISPR Lentivector set (Mouse) |
K3774801 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Human Tumor necrosis factor receptor superfamily member 25 (TNFRSF25) |
1-CSB-EP839000HU |
Cusabio |
- EUR 380.00
- EUR 214.00
- EUR 1309.00
- EUR 560.00
- EUR 873.00
- EUR 262.00
|
|
- MW: 22.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Human TNF Receptor Superfamily Member 25 (TNFRSF25) ELISA Kit |
abx259548-96tests |
Abbexa |
96 tests |
EUR 911.00 |
- Shipped within 5-12 working days.
|
Recombinant Human Death Receptor 3/DR3/TNFRSF25 (C-Fc) |
CJ74-10ug |
Novoprotein |
10ug |
EUR 141.00 |
Recombinant Human Death Receptor 3/DR3/TNFRSF25 (C-Fc) |
CJ74-1mg |
Novoprotein |
1mg |
EUR 1674.00 |
Recombinant Human Death Receptor 3/DR3/TNFRSF25 (C-Fc) |
CJ74-500ug |
Novoprotein |
500ug |
EUR 1115.00 |
Recombinant Human Death Receptor 3/DR3/TNFRSF25 (C-Fc) |
CJ74-50ug |
Novoprotein |
50ug |
EUR 303.00 |
Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-100ug |
QP7891-ec-100ug |
EnQuireBio |
100ug |
EUR 408.00 |
Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-10ug |
QP7891-ec-10ug |
EnQuireBio |
10ug |
EUR 200.00 |
Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-1mg |
QP7891-ec-1mg |
EnQuireBio |
1mg |
EUR 1632.00 |
Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-200ug |
QP7891-ec-200ug |
EnQuireBio |
200ug |
EUR 634.00 |
Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-500ug |
QP7891-ec-500ug |
EnQuireBio |
500ug |
EUR 1060.00 |
Recombinant Human TNFRSF25/ DR3/ TNFRSF12 Protein, His, E.coli-50ug |
QP7891-ec-50ug |
EnQuireBio |
50ug |
EUR 263.00 |
TNF Receptor Superfamily Member 25 (TNFRSF25) Antibody |
abx412445-01mg |
Abbexa |
0.1 mg |
EUR 509.00 |
|
TNF Receptor Superfamily Member 25 (TNFRSF25) Antibody |
abx412446-01mg |
Abbexa |
0.1 mg |
EUR 509.00 |
|
Monoclonal TNFRSF25 Antibody (monoclonal) (M06), Clone: 4E4 |
AMM04216G |
Leading Biology |
0.1mg |
EUR 484.00 |
Tnfrsf25 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6493002 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Tnfrsf25 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6493003 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Tnfrsf25 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6493004 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Tnfrsf25 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3774802 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Tnfrsf25 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3774803 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Tnfrsf25 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3774804 |
ABM |
1.0 ug DNA |
EUR 154.00 |
TNFRSF25 Protein Vector (Rat) (pPB-C-His) |
PV312098 |
ABM |
500 ng |
EUR 603.00 |
TNFRSF25 Protein Vector (Rat) (pPB-N-His) |
PV312099 |
ABM |
500 ng |
EUR 603.00 |
-
Key phrases: 3CL-protease; PL-protease; Pharmacophore; SARS-CoV-2 inhibitors; anti-HIV medication; molecular dynamics; pure merchandise; protease inhibitors.
Recombinant Human TNFRSF25/DR3/TNFRSF12 Protein
- The purpose of the current work was the event of a novel glycosaminoglycan (GAG)-based injectable formulation meant for intra-articular administration that ought to finest mimic the healthy synovial fluid.
- Hyaluronic acid (HA) was selectedn amongst GAG polymers, since it’s the most ample element of the synovial fluid. A DoE (Design of Experiment) method was used for the event of a formulation containing two HA (very excessive (VHMW) and low (LMW) molecular weight) grades. The rationale for this alternative is that thus far, no industrial product